مقاله بررسی و مقایسه حضور ژنIS و AmpC برروی سویه های اسینتوباکتر مقاوم

برای دریافت پروژه اینجا کلیک کنید

 مقاله بررسی و مقایسه حضور ژنIS و AmpC برروی سویه های اسینتوباکتر مقاوم دارای 2 صفحه می باشد و دارای تنظیمات در microsoft word می باشد و آماده پرینت یا چاپ است

فایل ورد مقاله بررسی و مقایسه حضور ژنIS و AmpC برروی سویه های اسینتوباکتر مقاوم  کاملا فرمت بندی و تنظیم شده در استاندارد دانشگاه  و مراکز دولتی می باشد.

این پروژه توسط مرکز مرکز پروژه های دانشجویی آماده و تنظیم شده است

توجه : در صورت  مشاهده  بهم ريختگي احتمالي در متون زير ،دليل ان کپي کردن اين مطالب از داخل فایل ورد مي باشد و در فايل اصلي مقاله بررسی و مقایسه حضور ژنIS و AmpC برروی سویه های اسینتوباکتر مقاوم،به هيچ وجه بهم ريختگي وجود ندارد


بخشی از متن مقاله بررسی و مقایسه حضور ژنIS و AmpC برروی سویه های اسینتوباکتر مقاوم :

سال انتشار: 1393
محل انتشار: اولین کنگره بین المللی و سیزدهمین کنگره ژنتیک ایران
تعداد صفحات: 2
نویسنده(ها):
مژگان سادات عبادی – دانشگاه آزاد اسلامی واحد تهران شمال
میترا صالحی – دانشگاه آزاد اسلامی واحد تهران شمال

چکیده:
مقدمه:اسینتوباکتر باکتری غیر تخمیری,هوازی وگرم منفی با ویرولانس بسیار پایین وخصوصیات فرصت طلب است.این باکتری به صورت گسترده در محیط های بیمارستانی دیده می شوند و در طی دهه گذشته از مهم ترین عوامل عفونت های بیمارستانی بوده اند.هدف ازمطالعه حاضرتعیین حضور ژنIS وAmpCدر بین سویه های این باکتری وارتباط بین حضور این دو ژن در بین نمونه های مقاوم دراسینتوباکتر می باشد.روش: در این بررسی 70 نمونه اسینتوباکتر از تراشه های زخم، خون، ادرار و بخش مراقبتهای ویژه جمعآوری گردید. در آزمایشگاه پس از شناسایی اسینتوباکتر با استفاده از روشهای کشت باکتری و بیوشیمیایی، تعیین حساسیت این باکتری به 12 آنتیبیوتیک با استفاده از روش دیسک دیفیوژن و براساس معیارCLSIانجام شد. سپس با استفاده از پرایمرهایIS و AmpCجهت بررسی حضور این ژن هادر نمونه های مقاوم به آنتیبیوتیک از روشPCRاستفاده گردید. در نهایت ارتباط بین وجود ژنهایIS و AmpCمقاومت دارویی مورد مطالعه قرار گرفت.نتایج: در تست آنتیبیوگرام, 70 نمونه جدا شده اسینتوباکتر مقاومت بسیار بالایی نسبت به آمپیسیلین سولباکتام، سفپیم، سفتازیدیم، سفاتکسیم و آمیکاسین نشان داد. همچنین مقاومت کمتری نسبت به توبرامایسین، سولباکتام و ایمی پنم مشاهده شد. آمپی سیلین سولباکتام و مروپنم موثرترین انتی بیوتیک در این بررسی بودند. در همه ی نمونه های مقاوم ژنIS و AmpCشناسایی شد. نتایج مطالعه حاضر نشان می دهد که عناصر الحاقیISها تاثیر به سزایی در افزایش بیان ژن AmpCکه نقش مهمی در اکتساب مقاومت به چند دارودر اسینتوباکتر می باشد، دارند.

برای دریافت پروژه اینجا کلیک کنید

مقاله بررسی نقش و رفتار اتصالات فولادی در تخریب پیشرونده

برای دریافت پروژه اینجا کلیک کنید

 مقاله بررسی نقش و رفتار اتصالات فولادی در تخریب پیشرونده دارای 8 صفحه می باشد و دارای تنظیمات در microsoft word می باشد و آماده پرینت یا چاپ است

فایل ورد مقاله بررسی نقش و رفتار اتصالات فولادی در تخریب پیشرونده  کاملا فرمت بندی و تنظیم شده در استاندارد دانشگاه  و مراکز دولتی می باشد.

این پروژه توسط مرکز مرکز پروژه های دانشجویی آماده و تنظیم شده است

توجه : در صورت  مشاهده  بهم ريختگي احتمالي در متون زير ،دليل ان کپي کردن اين مطالب از داخل فایل ورد مي باشد و در فايل اصلي مقاله بررسی نقش و رفتار اتصالات فولادی در تخریب پیشرونده،به هيچ وجه بهم ريختگي وجود ندارد


بخشی از متن مقاله بررسی نقش و رفتار اتصالات فولادی در تخریب پیشرونده :

سال انتشار: 1389

محل انتشار: پنجمین کنگره ملی مهندسی عمران

تعداد صفحات: 8

نویسنده(ها):

محمدرضا خواجه ساهوتی – دانشجوی کارشناسی ارشد سازه، دانشگاه آزاد اسلامی واحد دزفول
علیرضا خالو – عضو هیئت علمی و استاد دانشگاه صنعتی شریف
عباس بخشیایی – عضو هیئت علمی و استادیار دانشگاه تهران

چکیده:

تخریب پیشرونده هنگامی رخ می دهد که یک عضو اصلی یا اعضای کلیدی سازه شکسته شوند. سپس شکست عضو به سمت تخریب اعضای مجاور گسترش یافته و در نهایت کل سازه یا قسمتی از آن فرو می ریزد. برای مقاومت در برابر تخریب پیشرونده لازم است سازه توانایی پل زدن به ان طرف المان کلیدی را که شکسته فرض شده داشته باشد. در این حالت اتصال مهمترین نقش را ایفا می کند اتصال باید برای چرخش های بزرگ ناشی از حذف این المان و لنگر و نیروی کششی ایجاد شده در آن، طراحی شود دراین تحقیق عملکرد دو نوع اتصال مستقیم و اتصال SidePlate مورد بحث و بررسی قرار می گیرد و شکستهای محتمل در این اتصالات معرفی شده و مدل سه بعدی به روش اجزا محدود این دو نوع اتصال در برابر حذف این المان کلیدی ارزیابی می شود. نتایج نشان داده است که در اتصال مستقیم تمرکز تنش ها در جوش و هسته ستون ایجاد شده و اتصال رفتار کاملا نامناسبی دارد اما اتصال SidePlate علاوه بر عملکرد لرزه ای بالا بخوبی می تواند چرخشهای ناشی از حذف ستون را تحمل کرده و کمترین تنش را در چشمه اتصال ایجاد می نماید مفصل های پلاستیک را در تیر ایجاد می کند و دربرابر اثرات برهمکنش همزمان نیروی کششی و لنگر خمشی بخوبی مقاومت می کند و لذا از لحاظ مقاومت در برابر تخریب پیشرونده عملکرد مناسبی دارد.

برای دریافت پروژه اینجا کلیک کنید

مقاله نرم افزار Virtual pc

برای دریافت پروژه اینجا کلیک کنید

 مقاله نرم افزار Virtual pc دارای 37 صفحه می باشد و دارای تنظیمات در microsoft word می باشد و آماده پرینت یا چاپ است

فایل ورد مقاله نرم افزار Virtual pc  کاملا فرمت بندی و تنظیم شده در استاندارد دانشگاه  و مراکز دولتی می باشد.

این پروژه توسط مرکز مرکز پروژه های دانشجویی آماده و تنظیم شده است

توجه : در صورت  مشاهده  بهم ريختگي احتمالي در متون زير ،دليل ان کپي کردن اين مطالب از داخل فایل ورد مي باشد و در فايل اصلي مقاله نرم افزار Virtual pc،به هيچ وجه بهم ريختگي وجود ندارد


بخشی از متن مقاله نرم افزار Virtual pc :

کامپیوتر مجازی اصولاً به کامپیوتری گفته می‌شود که سخت افزارهای آن توسط نرم‌افزار شبیه‌سازی شده باشد. نرم‌افزارPC Virtual محصول شرکت Microsoft می‌باشد و نرم‌افزاری توانمند در زمینه، ساخت کامپیوتر مجازی می‌باشد.
این نرم‌افزار به شما امکان می‌دهد تا هر تعداد کامپیوتر مجازی که مایلید بسازید و آن‌ها را تک تک یا حتی با هم اجرا کنید. آخرین نسخه این نرم‌افزار در حال حاضر Virtual pc 2004 sp1 برای سیستم عاملWindows می‌باشد و خوشبختانه این نرم افزار از جولای 2006 توسط شرکت مایکروسافت به صورت رایگان ارائه می‌شود و با مراجعه به آدرس http://www.microsoft.com/virtualpc نسخه Full این نرم افزار را به صورت رایگان می‌توانید دانلود کنید.
تاریخچه: نرم افزار Virtual pc در ابتدا توسط شرکت Connectix ساخته شد اولین نسخه این نرم افزار برای macintish در ژوئن سال 1997 ارائه شد. 4 سال بعد در ژوئن 2001 اولین نسخه Virtual pc برای سیستم عامل windows (نسخه 0/4 ) ارائه شد. چون با گذشت زمان مشخص شد که ساخت کامپیوترهای مجازی مورد توجه سازمان‌هاست، مایکروسافت در فوریه 2003 تصمیم گرفت تا Virtual pc و یک محصول جدید به نام Virtual Server که مکمل Virtual pc است را از شرکت Connectix خریداری کند و بدین‌وسیله Virtual pc به Virtual pc Microsoftتغییر نام داد در حال حاضر مایکروسافت در حال کار برروی 2007 Virtual pc برای ویندوز Vista است و از تاریخ 11 اکتبر 2006 (19 مهر 1385) اقدام به ارائه نسخه Beta این نرم افزار کرده است. مایکروسافت به طور رسمی اعلام کرد که نسخه 2007
Virtual pc برای ویندوز Vista را نیز به طور رایگان در سال 2007 عرضه خواهد کرد.
نکته: باید توجه داشت که نرم افزار Virtual pc، کامپیوترهای مجازی از نوع Pc می‌سازد و نمی‌توانیم کامپیوترهای مجازی از نوع Apple macintosh را با استفاده از این نرم‌افزار بسازیم .
نیازهای سخت افزاری
برای نصب و اجرای Virtual PC 2004 SP1 باید سیستم شما دارای حداقل مشخصات زیر باشد:
– پردازنده: Pentiumlll, Pentiumll, Duron, Athlon یا Pentium4
– سرعت پردازنده: حداقل 400MHA (1GHz توصیه می‌شود)
– RAM : به سیستم عاملی که قرار است که درکامپیوتر مجازی نصب شود بستگی دارد.
– فضای مورد نیاز هاردیسک: به سیستم‌ عاملی که قرار است در کامپیوتر مجازی نصب شود بستگی دارد.
– سیستم عامل: Windows XP/2000
نکته1: اگر سیستم شما این حداقل را پشتیبانی نمی‌کند (به خصوص در مورد سیستم عامل، مثلاً ممکن است بخواهید از ویندوز 98 استفاده کنید) می توانید از نسخ‌های قدیمی‌تری از این نرم‌افزار که با سیستم شما همخوانی کافی داشته باشد، استفاده کنید.
نکته 2: هرچند مستنداتی که مایکروسافت راجع به این نرم‌افزار منتشر کرده، سیستم عامل ویندوز Server 2003 را جزو سیستم عامل‌های پشتیبانی شده قرار نداده است اما آزمایش‌هایی که روی این نرم‌افزار، در محیط این سیستم عامل انجام دادیم نشان داد که این نرم‌افزار به همان خوبی که در ویندوز XP Pro کار می‌کند در ویندوز Server 2003 هم کار می‌کند.
آشنایی با چند اصطلاح:
– OS: مخفف عبارت Operating System به معنی سیستم عامل می‌باشد.
– Host OS: یا همان سیستم عامل میزبان، به سیستم عاملی گفته می‌شود که نرم‌افزار Virtual PC را در آن نصب و اجرا می‌کنید.
– Virtual Machine: همان طور که گفته شد نرم‌افزار Virtual PC قادر است تا تعداد نامحدودی از کامپیوترهای مجازی را تولید و راه‌اندازی کند. به هریک از این کامپیوترهای مجازی یک Virtual Machine گفته می‌شود.
– Console: یک واحد کنترلی که کاربر از طریق آن با کامپیوتر ارتباط برقرارمی‌کند. Virtual PC Console در واقع واحد کنترل نرم افزار Virtual Machine است که به ما اجازه می‌دهد تا تمام اعمال کنترلی را برروی Virtual Machine انجام دهیم.
– Capture: این کلمه در اصطلاح برای حالتی به کار می‌رود که یک برنامه یا پردازش، کنترل یک وسیله ورودی را به دست می‌گیرد. در این حالت جریان داده‌های ورودی به آن نرم افزار خاص ارسال می‌شود.
– Physicl: این کلمه، در اصطلاح برای قطعاتی که به طور فیزیکی به کامپیوتر شما متصل شده باشند به کار می‌رود. این کلمه به عنوان متضادی برای کلمه Virtual به معنی مجازی استفاده می‌شود، مثلاً وقتی می‌گوییم Physical Memory منظورمان مقدار حافظه RAM می‌باشد که در اسلات‌های مادربورد نصب شده است و وقتی می‌گوییم در اسلات‌های مادربورد نصب شده است و وقتی می‌گوییم Virtual Memory منظور آن مقدار حافظه ای است که ویندوز با استفاده از هارددیسک برای جبران کمبود فضای RAM شبیه سازی کرده است.
– NAT: سرنام عبارت Network Address Translation می‌باشد و به فرایند تبدیل IP‌های اینترنت و بالعکس گفته می‌شود. این روند سبب می‌شود که بتوان تعداد زیادی از نشانی‌ها را بدون تمام کردن نشانی‌های IP اینترنت (که تعدادشان هم محدود است) در شبکه‌های خصوصی و اینترنت‌ها به کار برد.
Intranet: به یک شبکه درون سازمانی، اینترنت گفته می‌شود.

برای دریافت پروژه اینجا کلیک کنید

مقاله تنوع جمعیت های زنبور عسل بر اساس نشانگرهای مورفولوژیکی و ریزماهواره (microsatellite) در استان اردبیل

برای دریافت پروژه اینجا کلیک کنید

 مقاله تنوع جمعیت های زنبور عسل بر اساس نشانگرهای مورفولوژیکی و ریزماهواره (microsatellite) در استان اردبیل دارای 10 صفحه می باشد و دارای تنظیمات در microsoft word می باشد و آماده پرینت یا چاپ است

فایل ورد مقاله تنوع جمعیت های زنبور عسل بر اساس نشانگرهای مورفولوژیکی و ریزماهواره (microsatellite) در استان اردبیل  کاملا فرمت بندی و تنظیم شده در استاندارد دانشگاه  و مراکز دولتی می باشد.

این پروژه توسط مرکز مرکز پروژه های دانشجویی آماده و تنظیم شده است

توجه : در صورت  مشاهده  بهم ريختگي احتمالي در متون زير ،دليل ان کپي کردن اين مطالب از داخل فایل ورد مي باشد و در فايل اصلي مقاله تنوع جمعیت های زنبور عسل بر اساس نشانگرهای مورفولوژیکی و ریزماهواره (microsatellite) در استان اردبیل،به هيچ وجه بهم ريختگي وجود ندارد


بخشی از متن مقاله تنوع جمعیت های زنبور عسل بر اساس نشانگرهای مورفولوژیکی و ریزماهواره (microsatellite) در استان اردبیل :

شمال غرب آسیا منطقهای است که تنوع گسترده موفولوژیکی زنبور عسل در آنجا دیده میشود .(17)
جدایی جغرافیایی میتواند منجر به تمایز ژنتیکی جمعیتها به واسطه انتخاب محلی((Local selection و رانش ژنی

(Gene flow) شود و در نهایت باعث ایجاد گروههایی شود که نژاد نامیده میشوند .(6) از مدتها قبل برای زنبور عسل فقط چهار گونه شناخته شده بود. در حالی که طبق مطالعه فیلوژنتیکی، حداقل شش گونه از جنس آپیس

(Apis) در دنیا انتشار دارد .(5) زنبورعسل حشرهای بسیار سازش یافته با اکوسیستمهای متغیر در گستره آفریقا، اروپا

و قسمتهای مرکزی و غرب آسیا میباشد. در حدود 26

زیر گونه و اکوتیپهای (موجود سازش یافته با یک زیستگاه

خاص) متعدد گونه بر اساس رفتار،

صفات ظاهری و شواهد مولکولی معرفی شده است. برخی نژادها منطقه جغرافیایی وسیع و برخی دیگر مناطق کوچکی را اشغال میکنند .(18) بعضی از محققین از تفاوتهایی همچون واکنش به سرما، ابتلا به بیماری، ریتمهای (رقصهای) حین برقراری ارتباط و ویژگیهای یادگیری به عنوان عامل تعیین کننده تمایز بین گونهها استفاده کردهاند .(19)

462

مجله پژوهشهای سلولی و مولکولی (مجله زیست شناسی ایران) جلد 26، شماره 4، 1392

در زنبورها، از آغازگرهای ریزماهواره برای اولین بار در Apis melifera و Bombus terrestris استفاده شد و سپس برای سه نوع زنبور عسل بدون نیش استفاده گردید
.(8) ریزماهوارهها توالیهای ساده و تکراری کوتاهی((SSR

هستند که اگر طول آنها به حد کافی بلند و غیر منقطع باشد، به دلیل چند شکل بودن به عنوان نشانگرهای ژنتیکی مناسبی به کار میروند .(4) شمار زیادی از میکروستلایت ها برای ژنوم انسانی، حیوانات مدل و تعدادی از گیاهان زراعی توسعه پیدا کرده است. در زنبوران عسل نقشه پیوستگی ژنی برای گونه آپیس و چندین زنبور دیگر تهیه شده است .(18) فرانک و همکاران در سال 2001 در بررسی زنبوران عسل آفریقا با استفاده از نشانگرهای ریزماهواره و میتوکندریایی، نشان دادند که جایگاههای ریزماهواره به طور گسترده در جمعیتهای آفریقایی نسبت به اروپایی چندشکلی زیادی را نشان میدهد و این خود تفسیری بر اندازه بزرگ جمعیتها در آفریقا است .(10) با مطالعه 7 جایگاه ریز ماهواره در ساختار ژنتیکی زنبوران عسل مشخص شد که هیچ کدام از جایگاهها از تعادل هاردی– واینبرگ انحراف ندارند .(9)

استان اردبیل از لحاظ تولید عسل و پرورش زنبور عسل در ایران از اهمیت قابل توجهی برخوردار است. این مطالعه به منظور بررسی تنوع ژنتیکی بین جمعیتهای زنبورعسل موجود در برخی مناطق استان اردبیل با استفاده از نشانگر های مورفولوژیکی و مولکولی (ریز ماهواره) انجام شد.

مواد و روشها

-1 مطالعات مورفولوژیک: برای انجام مطالعات مورفولوژیک، از کندوهای مربوط به زنبورداریهای برخی شهرستانهای استان اردبیل (اردبیل، نمین، نیر، هیر، مشکین-

شهر، سرعین و گرمی) که دارای بیش از صد کلنی بودند و حدود 6 سال سابقه زنبورداری داشتند، نمونه برداری به عمل آمد. در هر منطقه، نمونه برداری به طور تصادفی از

3-1 کلنی و در طی ماههای تیر، مرداد و شهریور سال

1385 انجام شد. از هر کلنی در حدود 15 زنبور عسل کارگر انتخاب گردید. برای نمونه برداری از ظروف پلاستیکی دهان گشاد استفاده شد و زنبورها با احتیاط از داخل هر کندو و از روی شانهای زنبور عسل در داخل بطریهای پلاستیکی قرار داده شدند. صفات ظاهری روی 6

زنبور کارگر از هر کلنی اندازهگیری شد و در مورد اعضایی که به طور قرینه در بدن زنبور عسل وجود دارند، همیشه عضو سمت راست برای اندازهگیری انتخاب شد. از بین حدود 40 صفت ظاهری که برای متمایز ساختن نژادهای زنبور عسل دنیا استفاده میشود، 11 صفت ظاهری کمی

(جدول (3 و سه صفت کیفی ( شکل تومنتوم، وضعیت زاویه دیسکوئیدال و رنگ نیم حلقههای پشتی و شکمی ناحیه شکم) انتخاب شد. برای بررسی ویژگیهای مربوط به بال جلو، پس از جدا کردن بال سمت راست مدتی آن را در محلول الکل 70 درصد قرار داده و سپس بالها به ترتیب روی اسلایدهای دو جداره چیده شدند تا پس از تبخیر الکل به اسلایدها بچسبند و اندازه گیری روی آنها انجام شود. دادههای حاصل از اندازه گیری طول و زاویه رگبالها و شاخص کوبیتال در شناسنامه هر کلنی ثبت گردید. برای اندازهگیری طول خرطوم، طول و عرض بال جلویی، طول پای عقبی و سلول رادیال از استریو میکروسکوپ مجهز به عدسی مدرج استفاده شد. کلیه اندازهگیریها با استفاده از روش بین المللی روتنر انجام گرفت .(16)

-2 استخراج : DNA برای انجام مطالعات مولکولی، استخراج DNA با استفاده از روش نمکی بهینه ( Salting (out method با اندکی تغییرات انجام شد .(7) پس از جدا کردن قسمت سینه حشره و شستشوی آن با آب مقطر، نمونهها به لولههای میکروتیوب منتقل و با استفاده از لوله پلاستیکی خرد شدند. بافرهای استخراج CTAB وTNE به ترتیب به مقدار120µl و500µl به میکروتیوبها اضافه و مخلوط ورتکس گردید. آنزیم پروتئیناز K به مقدار 8

واحد در داخل یخ به نمونهها اضافه و در حمام آب 60

درجه سانتی گراد به مدت 12 ساعت اینکوبه شدند.

463

مجله پژوهشهای سلولی و مولکولی (مجله زیست شناسی ایران) جلد 26، شماره 4، 1392

مخلوط حاصل در دو نوبت با محلول فنل کلروفرم سانتریفیوژ ( 10000×g/min) و محلول رویی دور ریخته شد. برای رسوب DNA، 2/5 برابر اتانل سرد 100 درصد اضافه و پس از سانتریفیوژ و دور ریختن محلول رویی، رسوب حاصل با اتانل 70 درصد شستشو و در هوای آزاد خشک گردید. رسوب خشک شده در آب دیونیزه حل و پس از ارزیابی کمی و کیفی با روش اسپکتروفتومتری و الکتروفورز بر روی ژل آگارز 0/8 درصد، در فریزر نگهداری گردید.

-3 بررسی نشانگرهای ریزماهواره: در این تحقیق از 2

جایگاه ریز ماهوارهای AM2 وA88 استفاده شد (جدول

.(1 آغازگرهای AM2f وAM2B با استفاده از نرم افزار

Oligo 0.6 و الگو قرار دادن توالی ثبت شده به شماره

AJ509247طراحی گردید و آغازگرهای A88f و A88b بر اساس گزارشات قبلی ساخته شد(.(5 واکنش PCR در حجم 25 میکرولیتر شامل: 2 واحد آنزیم Taq پلیمراز، 1/2

میلیمول dNTP، 1/5 میلیمول MgCl2 ، 4 میلیمول از هر آغازگر و 30 نانوگرم DNA صورت گرفت. مراحـل واکنش PCR شامل 94 درجه سانتی گراد به مدت 3 دقیقه در یک چرخه، 94 درجه سانتی گراد به مدت 1 دقیقه، 54

درجه سانتی گراد به مدت 30 ثانیه و 72 درجه سانتی گراد به مدت 1 دقیقه در 34 چرخه و 72 درجه سانتی گراد به مدت 5 دقیقه جهت تکمیل نهایی تکثیر بود. محصول

PCR در سطح ژل آگارز 2 درصد و با رنگ آمیزی اتیدیوم بروماید مورد بررسی اولیه قرار گرفت و جهت ارزیابی و سنجش دقیق آللهای ریز ماهواره از الکتروفورز محصول
PCR بر روی ژل پلی آکریلامید 12 درصد استفاده شد.

-4 تجزیه و تحلیل آماری: پس از اندازهگیری صفات ظاهری، تجزیه واریانس و محاسبه میانگین، معیار اشتباه صفات اندازه گیری شده با استفاده از نرم افزار SPSS14

انجام شد .(12) برای بررسی میزان دوری و نزدیکی جمعیتها و نژادهای مورد مطالعه از روش تجزیه خوشهای

با روش حداقل واریانس وارد (Ward) استفاده شد .(12)

تجزیه تنوع ژنتیکی جمعیتها در جایگاههای مورد نظر شامل تعداد آللها در هر لوکوس، تعداد ژنوتیپها و میزان تنوع در هر جمعیت و لوکوس، فراوانی آللی، هتروزیگوسیتی مورد انتظار و مشاهده شده و تعادل هاردی واینبرگ با استفاده از نرم افزار Popgen3.2 انجام گرفت

.(13) گروهبندی نژادها براساس دادههای مولکولی با استفاده از تجزیه خوشهای به روش UPGMA انجام شد.

نتایج

برای شناسایی نژادهای مختلف زنبورعسل با استفاده از کلیدهای شناسایی روتنر((16، از یازده صفت مختلف استفاده شد. پس از اندازه گیری صفات مذکور در نمونههای زنبورعسل و مقایسه آنها با کلید شناسایی در مجموع چهار نژاد در مناطق مختلف استان اردبیل شناسایی شد. نژادهای شناسایی شده عبارت بودند از: نژاد ایرانی، نژاد ایتالیایی، هیبرید میدنایت، هیبرید استارلاین. میانگین این صفات در چهار نژاد در جدول 3 مشاهده میشود.

تجزیه واریانس صفات کمی در نژادهای زنبور عسل نشان داد که بین نژادها در صفات کمی کوبیتال A، کوبیتالB،

طول خرطوم، طول پای عقبی و زاویه A4 اختلاف معنی-

داری وجود دارد ( جدول .(2 به غیر از صفات مورد استفاده در شناسایی، صفات مورفولوژیکی مختلفی (جدول

(4 در این نژادها اندازهگیری شد. میانگین و معیار اشتباه صفات اندازهگیری شده در جدول 4 نشان داده شده است.

برای مقایسه نژاد ایرانی با سایر نژادهای وارد شده به استان اردبیل، این نژادها بر اساس صفات مورفولوژیکی و با استفاده از روش تجزیه خوشهای گروهبندی شدند.

گروه بندی جمعیتها با استفاده از صفات کیفی از قبیل رنگ نیم حلقههای پشتی، شکل تومنتوم و وضعیت زاویه دیسکوئیدال، صفات کمی از قبیل شاخص کوبیتال و طول خرطوم، طول و زاویه رگبالها و ترکیب صفات مذکور

464

مجله پژوهشهای سلولی و مولکولی (مجله زیست شناسی ایران) جلد 26، شماره 4، 1392

انجام گرفت. نتیجه گروهبندی حاصل از صفات کیفی در تفکیک شدند و این مسئله نشان میدهد که صفات کیفی
شکل 1 دیده میشود. در این گروهبندی جمعیتهای نژاد در تمایز جمعیتهای مورد مطالعه بهتر عمل کرده است.
ایرانی، ایتالیایی، استارلاین و میدنایت به خوبی از هم

جدول -1 مشخصات آغازگرهای مورد استفاده برای تکثیر جایگاههای ریزماهواره در زنبور عسل
نام آغازگر توالی ریزماهواره لوکوس مرجع

AM2f GGAGCGGAGAAGACTTCACC AJ509247 این تحقیق
AM2b GATCGGGAACCGTAGAAACC AJ509247 این تحقیق
A88f CGAATTAACCGATTTGTCG AJ509283 استوپ و همکاران (1995)
A88b GATCGCAATTATTGAAGGAG AJ509283 استوپ و همکاران (1995)

جدول-2 نتایج حاصل ازتجزیه واریانس یکطرفه برای صفات کمی مورد مطالعه

منابع درجه میانگین
تغییر آزادی مربعات
(df) (MS)
شاخص کوبیتال کوبیتال طول طول بال عرض بال طول پای زاویه زاویه زاویه طول
کوبیتال a b خرطوم جلویی جلویی عقبی G18 D7 A4 سلول
رادیال
بین 3 0/22ns 0/19* 0/026* 4/39** 0/045 ns 0/045 ns 0/704** 7/99 ns 7/01 ns 30/76** 0/003 ns
گروه
داخل 176 0/110 0/005 0/005 0/058 0/074 0/008 0/103 3/82 3/82 4/56 0/007
گروه

ns، * و ** به ترتیب غیر معنیدار، معنیدار در سطح 5 و 1 درصد

شکل -1 نمودار درختی حاصل از تجزیه خوشهای با روش حداقل واریانس وارد (Ward) برای جمعیتهای زنبور عسل با به کار بردن صفات کیفی: جمعیتهای گروه A مربوط به نژاد ایتالیایی، گروه B مربوط به نژاد هیبرید میدنایت، گروه C مربوط به نژاد ایرانی و گروه D مربوط به هیبریدهای میدنایت و استارلاین است.

465

مجله پژوهشهای سلولی و مولکولی (مجله زیست شناسی ایران) جلد 26، شماره 4، 1392

شکل -2 نمودار درختی حاصل از تجزیه خوشهای با روش حداقل واریانس وارد (Ward) برای جمعیتهای زنبور عسل با بکار بردن صفات کمی:

گروههای A وG وD مربوط به اقلیم نیمه خشک و گروههای B و F مربوط به اقلیم نیمه مرطوب و گروه های G و C مربوط به اقلیم نیمه خشک و نیمه مرطوب است.

گروه بندی جمعیتها با استفاده از صفات کمی نیز به طور جداگانه انجام شد (شکل .(2 در این گروهبندی نژادها به خوبی از هم تفکیک نشدهاند. بنابراین، نمیتوان تنها با استفاده از صفات کمی، جمعیتهای مزبور را از هم مجزا کرد. در حالی که تفکیک جمعیتها بیشتر با شرایط اقلیمی آنها مطابقت داشت. در این نمودار جمعیتهای مربوط به اقلیمهای نیمه خشک و نیمه مرطوب در گروههای جداگانهای قرار گرفتند.

در گروهبندی جمعیتها و نژادها با ترکیب دادههای کمی

(تومنتوم، رنگ نیم حلقه ها و وضعیت زاویه دیسکوئیدال)و دادههای کیفی ( طول بال جلویی، شاخص کوبیتال، طول خرطوم، طول و زاویه رگبالها)، جمعیتها تا حدود زیادی از هم تفکیک گردیدند (شکل .(3 بطوریکه مشاهده میگردد، نژادهای ایرانی و ایتالیایی در این نمودار کاملاً از هم مجزا شدهاند. اما نژادهای میدنایت و استارلاین همانند نمودار ردهبندی جمعیتها با استفاده از صفات کیفی به طور کامل از هم مجزا نشدند. همچنین گروهبندی جمعیتها بر اساس شرایط اقلیمی تا حدودی منطبق با گروه بندی جمعیتها بر اساس دادههای کیفی و کمی بود.

جهت بررسی تنوع ژنتیکی از دو جایگاه ریزماهواره نیز استفاده گردید. آغازگر AM2 پلی مورفیسم و تنوع نواری

قابل توجهی نشان داد. این آغازگر چهار آلل در چهار جایگاه ژنی تولید کرد که هر چهار آلل چند شکل بودند.
آغازگر A88 دو نوار در دو لوکوس نشان داد که هر دو نوار مونومورف بودند. برای تعیین تعادل هاردی- واینبرگ از آزمون کای اسکوئر برای یک جایگاه ژنی استفاده شد.
براساس این روش جمعیت ایتالیایی برای جایگاه ژنی

AM2در سطح 0/05 از تعادل انحراف نشان دادند 0/05)

. (P نتایج حاصل از این تحقیق نشان داد که با استفاده از این آغازگر، میزان هتروزیگوسیتی آللها تا حدودی متفاوت است که امری کاملاً طبیعی است. مقادیر هتروزیگوسیتی مشاهده شده (Ho) و هتروزیگوسیتی مورد انتظار (He) در هر جایگاه ژنی و برای هر جمعیت با استفاده از شاخص نی (Nei) محاسبه شد

اشتراک‌گذاری:

برای دریافت پروژه اینجا کلیک کنید

بررسی تحولات جمعیت و حاشیه نشینی شهر اهواز و تاثیر آن بر فعالیتهای اقتصادیدر اجتماعی

برای دریافت پروژه اینجا کلیک کنید

 بررسی تحولات جمعیت و حاشیه نشینی شهر اهواز و تاثیر آن بر فعالیتهای اقتصادیدر اجتماعی دارای 20 صفحه می باشد و دارای تنظیمات در microsoft word می باشد و آماده پرینت یا چاپ است

فایل ورد بررسی تحولات جمعیت و حاشیه نشینی شهر اهواز و تاثیر آن بر فعالیتهای اقتصادیدر اجتماعی  کاملا فرمت بندی و تنظیم شده در استاندارد دانشگاه  و مراکز دولتی می باشد.

توجه : در صورت  مشاهده  بهم ريختگي احتمالي در متون زير ،دليل ان کپي کردن اين مطالب از داخل فایل ورد مي باشد و در فايل اصلي بررسی تحولات جمعیت و حاشیه نشینی شهر اهواز و تاثیر آن بر فعالیتهای اقتصادیدر اجتماعی،به هيچ وجه بهم ريختگي وجود ندارد


بخشی از متن بررسی تحولات جمعیت و حاشیه نشینی شهر اهواز و تاثیر آن بر فعالیتهای اقتصادیدر اجتماعی :

سال انتشار : 1393

نام کنفرانس یا همایش : کنفرانس بين المللي علوم رفتاري و مطالعات اجتماعي

تعداد صفحات : 20

چکیده مقاله:

شهر اهواز به عنوان هفتمین کلان شهرکشور به لحاظ رشد جمعیتی که دارد متاسفانه با وجود داشتن ظرفیت های اقتصادی و طبیعی در بسیاری از موارد جوابگوی ساکنان خود نیست و با معضلات و مشکلات اجتماعی، اقتصادی، فرهنگی، سیاسی، فیزیکی و… برای جامعه شهرنشین خود روبه رو ست. همچنین به دلیل مرکز اداری -سیاسی استان خوزستان و مرکز منطقه جنوب غربی کشور از موقعیت سیاسی و اقتصادی خاصی برخوردار بوده، و آن را به یک شهر مهاجرپذیر تبدیل کرده است، به گونه ای که در سال 1385 حدود 24 % جمعیت استان و 35.3 %نقاط شهری استان را به خود اختصاص داده است. هدف پژوهش حاضر، بیان تحولات جمعیتی بر اثر رشد طبیعی و مهاجرت و عواقب ناشی از رشد بی رویه آن است. گسترش روز افزون شهر و رشد فرایند جمعیت و وجود برخی از امکانات رفاهی، فرهنگی، شغلی، آموزشی و دیگر امکانات باعث شده تا انگیزه ها برای هجوم به این شهر افزایش یافته و باعث ایجاد رشد ناهماهنگ و نابهنجاری گردد، پس چنین فرایندی منجربه دسترسی ناکافی به مسکن، خدمات اصلی شهری، سیستم حمل و نقل، اشتغال، گسترش فقر، ایجاد حاشیه نشینی و ابنیه بی کیفیت و…. در اهواز شده که گاهی موجب تهدید حیات شهروندان نیز می گردد. نتایچ نشان می دهد طی سالهای 35-85 ، نرخ رشد سالیانه آن 4.34 % و تراکم نسبی از 48.02 به 44.38 نفر در هکتار رسیده است. بعد خانوار از بیش 5.5 نفر به 4.64 نفر در سال 1385 کاهش می یابد. 23.4 میانه سنی سال 85 بوده که نشانه جوانی جمعیت، مهاجرپذیری، و نرخ بالای موالید یه- ویژه در مناطق حاشیه نشین است. تعداد خانوار در واحد مسکونی 1.06 و تعداد نفر در واحد مسکونی 4.9 نفر بوده که نسبت به سایر کلان شهرها وضعیت بدتری را دارا می باشد. روش تحقیق این مقاله از نوع تحلیلی کاربردی، و به روش کتابخانه ای و مراجعه به کتابخانه سازمان ها، آمارنامه ها و سرشماری ها، مصاحبه حضوری با مسئولین و کارشناسان مربوطه،گردآوری شده و پس ازآن تحلیل های لازم به شکل نوشتاری، جدول و نمودار صورت گرفته است.

برای دریافت پروژه اینجا کلیک کنید

نقش مقطع تحصیلی در ایجاد پایداری اجتماعی در محیط آموزشی با تاکید بر مشارکت و تعاملات اجتماعی

برای دریافت پروژه اینجا کلیک کنید

 نقش مقطع تحصیلی در ایجاد پایداری اجتماعی در محیط آموزشی با تاکید بر مشارکت و تعاملات اجتماعی دارای 5 صفحه می باشد و دارای تنظیمات در microsoft word می باشد و آماده پرینت یا چاپ است

فایل ورد نقش مقطع تحصیلی در ایجاد پایداری اجتماعی در محیط آموزشی با تاکید بر مشارکت و تعاملات اجتماعی  کاملا فرمت بندی و تنظیم شده در استاندارد دانشگاه  و مراکز دولتی می باشد.

توجه : در صورت  مشاهده  بهم ريختگي احتمالي در متون زير ،دليل ان کپي کردن اين مطالب از داخل فایل ورد مي باشد و در فايل اصلي نقش مقطع تحصیلی در ایجاد پایداری اجتماعی در محیط آموزشی با تاکید بر مشارکت و تعاملات اجتماعی،به هيچ وجه بهم ريختگي وجود ندارد


بخشی از متن نقش مقطع تحصیلی در ایجاد پایداری اجتماعی در محیط آموزشی با تاکید بر مشارکت و تعاملات اجتماعی :

سال انتشار : 1394

نام کنفرانس یا همایش : اولين همايش ملي پيشرفت ها و چالش ها در علوم، مهندسي و فناوري

تعداد صفحات : 5

چکیده مقاله:

محیط های آموزشی به خصوص دانشگاه ها و دانشکده ها ، فضاهایی هستند که دانشجویان از نقاط مختلف و با فرهنگ ها و آداب و رسوم های گوناگون در آن حضور پیدا می کنند و شاید به دلیل این تفاوت ها، مشارکت اجتماعی لازم، بین دانشجویان با چالش مواجه شود از طرفی مشارکت اجتماعی به عنوان یکی از شکل های پایداری اجتماعی در فضای آموزشی می باشد در نتیجه امکان به وجود آمدن ناپایداری اجتماعی در فضای آموزشی وجود دارد. هدف از این تحقیق این است که به بررسی تاثیر مقطع تحصیلی بر تعاملات و مشارکت اجتماعی و در نتیجه به تاثیر مقطع تحصیلی بر پایداری اجتماعی در محیط های آموزشی پرداخته شود. در راستای دستیابی به این هدف، از روش تحقیق پیمایشی استفاده شده است و از طریق مطالعات کتابخانه ای به جمع آوری اطلاعات پرداخته شده است و سپس به توزیع پرسشنامه و آنالیز اطلاعات از طریق نرم افزار spss این نتیجه حاصل شد که با افزایش سطح تحصیلات و ارتقاء سطح علمی احساس نیاز به مشارکت اجتماعی در دانشجویان مهندسی معماری بیشتر احساس می شود و همکلاسی ها به میزان زیادی باعث پیشرفت درسی یکدیگر شده اند.

برای دریافت پروژه اینجا کلیک کنید

مقاله اعتبارسنجی صنعتی مدل Plitt در پیش بینی حد جدایش کلاسیفایرهای هیدرولیکی

برای دریافت پروژه اینجا کلیک کنید

 مقاله اعتبارسنجی صنعتی مدل Plitt در پیش بینی حد جدایش کلاسیفایرهای هیدرولیکی دارای 7 صفحه می باشد و دارای تنظیمات در microsoft word می باشد و آماده پرینت یا چاپ است

فایل ورد مقاله اعتبارسنجی صنعتی مدل Plitt در پیش بینی حد جدایش کلاسیفایرهای هیدرولیکی  کاملا فرمت بندی و تنظیم شده در استاندارد دانشگاه  و مراکز دولتی می باشد.

این پروژه توسط مرکز مرکز پروژه های دانشجویی آماده و تنظیم شده است

توجه : در صورت  مشاهده  بهم ريختگي احتمالي در متون زير ،دليل ان کپي کردن اين مطالب از داخل فایل ورد مي باشد و در فايل اصلي مقاله اعتبارسنجی صنعتی مدل Plitt در پیش بینی حد جدایش کلاسیفایرهای هیدرولیکی،به هيچ وجه بهم ريختگي وجود ندارد


بخشی از متن مقاله اعتبارسنجی صنعتی مدل Plitt در پیش بینی حد جدایش کلاسیفایرهای هیدرولیکی :

سال انتشار: 1393
محل انتشار: پنجمین کنفرانس مهندسی معدن
تعداد صفحات: 7
نویسنده(ها):
حمید خوشدست – استادیار بخش مهندسی معدن، مجتمع اموزش عالی زرند دانشگاه شهید باهنر کرمان
وحیده شجاعی – دانشجوی دکتری فرآوری مواد معدنی بخش مهندسی معدن دانشکده فنی و مهندسی دانشگاه شهید باهنر کرمان

چکیده:
در این پزوهش کارایی مدل Plitt جهت پیش بینی ضریب توزیع و حد جدایش چند نمونه کلاسیفایر صنعتی شامل هیدراسیکلون با جریان دورانی کلاسیفایر هیدرولیکی با جریان قائم و کلاسیفایر مارپیچی با جریان افقی مورد ارزیابی قرار گرفته است. نتایج مدل سازی نشان داد که دقت مدل برای کلاسیفایرهای مختلف بسیار متفاوت است و مستقیما به کارایی و دقت طبقه بندی انها بستگی دارد. خطای پیش بینی حد جدایش برای هیدروسیکلون ها حدود 20% برای کلاسیفایر قائم 2% و برای کلاسیفایر مارپیچی 30% به دست آمد تطابق ضرایب توزیع پیش بینی شده با واقعی نشان داد که با فاصله گرفتن منحنی توزیع از حالت ایده آل و یا وجود تغییرات غیرمعمولی مانند شکل قلاب ماهی در نمودار کارایی مدل Plitt را به شدت کاهش می دهد. بررسی ضرایب تعیین نمودارها نشان داد که بهترین برازش متعلق به کلاسیفایر قائم است. این نتیجه را می توان به زمان ماند و در نتیجه دقت طبقه بندی بیشتر کلاسیفایر قائم نسبت داد که منحنی توزیع آن را به حالت ایده آل بسیار نزدیک نموده است.

برای دریافت پروژه اینجا کلیک کنید

مقاله استفاده از شاخص های فیزیولوژیک برای گزینش ژنوتیپ های مقاوم به خشکی در کلزا

برای دریافت پروژه اینجا کلیک کنید

 مقاله استفاده از شاخص های فیزیولوژیک برای گزینش ژنوتیپ های مقاوم به خشکی در کلزا دارای 1 صفحه می باشد و دارای تنظیمات در microsoft word می باشد و آماده پرینت یا چاپ است

فایل ورد مقاله استفاده از شاخص های فیزیولوژیک برای گزینش ژنوتیپ های مقاوم به خشکی در کلزا  کاملا فرمت بندی و تنظیم شده در استاندارد دانشگاه  و مراکز دولتی می باشد.

این پروژه توسط مرکز مرکز پروژه های دانشجویی آماده و تنظیم شده است

توجه : در صورت  مشاهده  بهم ريختگي احتمالي در متون زير ،دليل ان کپي کردن اين مطالب از داخل فایل ورد مي باشد و در فايل اصلي مقاله استفاده از شاخص های فیزیولوژیک برای گزینش ژنوتیپ های مقاوم به خشکی در کلزا،به هيچ وجه بهم ريختگي وجود ندارد


بخشی از متن مقاله استفاده از شاخص های فیزیولوژیک برای گزینش ژنوتیپ های مقاوم به خشکی در کلزا :

سال انتشار: 1385

محل انتشار: نهمین کنگره علوم زراعت و اصلاح نباتات

تعداد صفحات: 1

نویسنده(ها):

امیر غریب عشقی – مرکز تحقیقات کشاورزی و منابع طبیعی استان اردبیل

چکیده:

به منظور بررسی عکس العمل ارقام کلزای پاییزه در شرایط تنش آبی و تعیین شاخص های فیزیولوژیک مرتبط با گزینش ارقام کلزای مقاوم به تنش آبی ، آزمایشی با 20 تیمار در مزرعه مر کز تحقیقات کشاورزی استان اردبیل طی دو سال 81-1380 و 82-1381 انجام گرفت. طرح در قالب بلوک های کامل تصادفی (RCB) اجرا شد . دو آزمایش همزمان بهمنظور ایجاد شرایط تنش صورت گرفت . آزمایش اول در مزرعه آبی مرکز تحقیقات مغان کاشته شد و طبق روال نرمال کاشت ، آبیاری و مراقبت گردید . آزمایش دوم هم در مزرعه آبی مر کز تحقیقات مغانتحت شرایط یکبار آبیاری پس از کاشت انجام گرفت و تا پایان آزمایش، هیچ آبیاری تکمیلی انجام نشد و صرفًا تأمین رطوبت گیاه مبتنی بر بارش های فصلی بوده است . پس از کشت و طی فصل رشد ، صفات فیزیولو ژیک مرتبط با تنش خشکی از جمله ، پایداری غشاء سیتوپلاسمی، محتوای آب برگ، EC برگ در مرحله گلدهی ، و صفات مرفولوژیک از جمله ، عملکرد، ارتفاع، تعداد غلاف در بوته ، وزن هزار دانه، تعداد دانه در غلاف ، طول دوره گلدهی و تاریخ رسیدن ، مورد اندازه گیری قرار گرفت . در پایان هر سال ، تجزیه واریانس ساده و پس از دو سال آزمایش ، تجزیه واریانس مرکب با فرض ثابت بودن اثر سال برای صفات مذ کور انجام شد و مقایسه میانگین ها نیز با استفاده از آزمون چند دامنه ای دا نکن صورت گرفت. نتایج حاصل نشان داد که: تنش خش کی تاثیر فاحشی بر میزان عمل کرد، پر شدن غلاف ها در بوته ، ارتفاع گیاه ، و تاریخ رسیدن دارد . همچنین کمبود آب و تنش خشکی باعث افزایش میزان EC، از طریق پارگی جداره سیتوپلاسمی و نشت مواد یونی به فضاهای بین سلولی ، و افزایش غلظت مواد درون سیتوپلاسمی و کاهش شدید محتوای آب سلول ها می گردد . همچنین مشخص گردید که از صفات فیزیولو ژیک اندازه گیری شده می توان در اسکرین کردن اولیه ژنوتیپ های مقاوم به تنش خشکی استفاده کرد. به این ترتیب که ارقام مقاومتر به کمبود آب ، در طی فصل رشد ، دارای EC پایین تر، محتوای نسبی آب بالاتر و پایداری غشاء سیتوپلاسمی بالاتری می باشند. همچنین مشخص گردید ارقام هایولا ، اورکا، هرالد و Darmoy به ترتیب دارای بیشترین عمل ک رد در شرایط تنش بودند و ارقام سرز و VDHSOO3 و Gyder دارای کمترین عملکرد دانه بودند.

برای دریافت پروژه اینجا کلیک کنید

مقاله کلاهبر داری رایانه ای جلوهای نوین و ممتایز از کلاهبرداری سنتی

برای دریافت پروژه اینجا کلیک کنید

 مقاله کلاهبر داری رایانه ای جلوهای نوین و ممتایز از کلاهبرداری سنتی دارای 14 صفحه می باشد و دارای تنظیمات در microsoft word می باشد و آماده پرینت یا چاپ است

فایل ورد مقاله کلاهبر داری رایانه ای جلوهای نوین و ممتایز از کلاهبرداری سنتی  کاملا فرمت بندی و تنظیم شده در استاندارد دانشگاه  و مراکز دولتی می باشد.

این پروژه توسط مرکز مرکز پروژه های دانشجویی آماده و تنظیم شده است

توجه : در صورت  مشاهده  بهم ريختگي احتمالي در متون زير ،دليل ان کپي کردن اين مطالب از داخل فایل ورد مي باشد و در فايل اصلي مقاله کلاهبر داری رایانه ای جلوهای نوین و ممتایز از کلاهبرداری سنتی،به هيچ وجه بهم ريختگي وجود ندارد


بخشی از متن مقاله کلاهبر داری رایانه ای جلوهای نوین و ممتایز از کلاهبرداری سنتی :

سال انتشار: 1390

محل انتشار: همایش منطقه ای چالشهای جرایم رایانه ای در عصر امروز

تعداد صفحات: 14

نویسنده(ها):

عباسعلی اکبری – عضو هیئت علمی دانشگاه آزاد اسلامی واحد مراغه ، مراغه -ایران

چکیده:

جرم کلاهبرداری رایانه ای جلوه ای نوین ودر عین حال متمایز از نوع سنتی آن در باب جرایم علیه اموال ومالکیت مورد بحث قرار می گیرد . ملزومات و شرایط کلاهبرداری سنتی در مورد نوع رایانه ای آن قابل اعمال نیست . اسناد بین المللی به خصوص کنوانسیون جرایم سایبر 2001 صرف استفاده غیره مجازه از رایانه ای به قصد تحصیل هر نوع منفعت اقتصادی و ایراد ضرر به دیگری را مشمول کلاهبرداری رایانه ای می داند . قا نون گذار ایران با تصویب ماده 67 قانون تجارت الکترونیکی مصوب سال 82 وقید شرطاغفال متقلبانه مال باخته از کلاهبرداری سنتی فاصله چندانی نگرفته است .

برای دریافت پروژه اینجا کلیک کنید

پیشبینی رضایت زناشویی بر اساس باورهای فراشناخت در دانشجویان متأهل

برای دریافت پروژه اینجا کلیک کنید

 پیشبینی رضایت زناشویی بر اساس باورهای فراشناخت در دانشجویان متأهل دارای 5 صفحه می باشد و دارای تنظیمات در microsoft word می باشد و آماده پرینت یا چاپ است

فایل ورد پیشبینی رضایت زناشویی بر اساس باورهای فراشناخت در دانشجویان متأهل  کاملا فرمت بندی و تنظیم شده در استاندارد دانشگاه  و مراکز دولتی می باشد.

توجه : در صورت  مشاهده  بهم ريختگي احتمالي در متون زير ،دليل ان کپي کردن اين مطالب از داخل فایل ورد مي باشد و در فايل اصلي پیشبینی رضایت زناشویی بر اساس باورهای فراشناخت در دانشجویان متأهل،به هيچ وجه بهم ريختگي وجود ندارد


بخشی از متن پیشبینی رضایت زناشویی بر اساس باورهای فراشناخت در دانشجویان متأهل :

سال انتشار : 1394

نام کنفرانس یا همایش : کنفرانس بين المللي علوم و مهندسي

تعداد صفحات : 5

چکیده مقاله:

هدف از این پژوهش پیشبینی رضایت زناشویی بر اساس باورهای فراشناخت بود . به این منظور 022 نفر از دانشجویان متأهل دانشگاه آزاد اسلامی واحد علوم تحقیقات تهران 4931 بهصورت تصادفی خوشهای انتخاب شدند . برای سنجشرضایت زناشویی از مقیاس رضایت زناشویی انریچ ) ENRICH-14 ( ، برای سنجش باورهای فراشناخت از مقیاس فراشناختی ) MCQ-92 ( استفادهشده است . برای بررسی فرضیههای پژوهش از آزمون آماری رگرسیون چندگانه استفادهشده است . نتایج پژوهش نشان داد که میتوان رضایت زناشویی را بر اساس باورهای فراشناخت پیشبینی کرد . از بین ابعاد باورهای فراشناخت در سطح0/05 وقوف شناختی و عدم اطمینان به حافظه ) اعتقاد شناختی ( بهصورت منفی و معنادار ، رضایت زناشویی را پیشبینی میکنند

برای دریافت پروژه اینجا کلیک کنید